Hui Lin @Google Ming Li @Amazon
Speech Recognition | \(\longrightarrow\) | Get your facts first, then you can distort them as you please. | |
Music generation | \(\emptyset\) | \(\longrightarrow\) | |
Sentiment classification | Great movie ? Are you kidding me ! Not worth the money. | \(\longrightarrow\) | |
DNA sequence analysis | ACGGGGCCTACTGTCAACTG | \(\longrightarrow\) | AC GGGGCCTACTG TCAACTG |
Machine translation | 网红脸 | \(\longrightarrow\) | Internet celebrity face |
Video activity recognition | \(\longrightarrow\) | Running | |
Name entity recognition | Use Netlify and Hugo. | \(\longrightarrow\) | Use Netlify and Hugo. |
x: Use(\(x^{<1>}\)) Netlify(\(x^{<2>}\)) and(\(x^{<3>}\)) Hugo(\(x^{<4>}\)) .(\(x^{<5>}\))
y: 0 (\(y^{<1>}\)) 1(\(y^{<2>}\)) 0(\(y^{<3>}\)) 1(\(y^{<4>}\)) 0(\(y^{<5>}\))
\(x^{(i)<t>}\), \(T_x^{(i)}\) (\(i^{th}\) sample)
\(y^{(i)<t>}\), \(T_y^{(i)}\) (\(i^{th}\) sample)
\(\left[\begin{array}{c} a[1]\\ aaron[2]\\ \vdots\\ and[360]\\ \vdots\\ Hugo[4075]\\ \vdots\\ Netlify[5210]\\ \vdots\\ use[8320]\\ \vdots\\ Zulu[10000] \end{array}\right]\Longrightarrow use=\left[\begin{array}{c} 0\\ 0\\ \vdots\\ 0\\ \vdots\\ 0\\ \vdots\\ 0\\ \vdots\\ 1\\ \vdots\\ 0 \end{array}\right], Netlify=\left[\begin{array}{c} 0\\ 0\\ \vdots\\ 0\\ \vdots\\ 0\\ \vdots\\ 1\\ \vdots\\ 0\\ \vdots\\ 0 \end{array}\right], and=\left[\begin{array}{c} 0\\ 0\\ \vdots\\ 1\\ \vdots\\ 0\\ \vdots\\ 0\\ \vdots\\ 0\\ \vdots\\ 0 \end{array}\right], Hugo=\left[\begin{array}{c} 0\\ 0\\ \vdots\\ 0\\ \vdots\\ 1\\ \vdots\\ 0\\ \vdots\\ 0\\ \vdots\\ 0 \end{array}\right]\)